Introduction to Bulk B Cell Repertoire Analysis using the Immcantation Framework

The field of high-throughput adaptive immune receptor repertoire sequencing (AIRR-seq) has experienced significant growth in recent years, but this growth has come with considerable complexity and variety in experimental design. These complexities, combined with the high germline and somatic diversity of immunoglobulin repertoires, present analytical challenges requiring specialized methodologies. In this tutorial, we present an example pipeline for processing bulk BCR data.

  • The tutorial is available as a R Markdown notebook in the Immcantation repository: intro-lab.Rmd.

This tutorial covers:

  • V(D)J gene annotation and novel polymorphism detection

  • Inference of B cell clonal relationships

  • Diversity analysis

  • Lineage tree reconstruction

  • Mutational load profiling

  • Modeling of somatic hypermutation (SHM) targeting

  • Quantification of selection pressure

For installation of docker used in this tutorial, go to the link given below:

https://immcantation.readthedocs.io/en/latest/docker/intro.html

Software versions

Use this command to list the software versions:

versions report

## immcantation: devel
## date: 2026.06.06
## 
## presto: 0.7.10dev
## changeo: 1.3.5dev
## alakazam: 1.4.3.999
## shazam: 1.3.2.999
## tigger: 1.1.3
## scoper: 1.5.0.999
## dowser: 2.4.1.999
## enchantr: 0.1.25
## prestor: 0.0.7
## piglet: 1.0.1
## rabhit: 0.2.5
## rdi: 1.0.0
## igphyml: 2.0.0
## seurat: 5.5.0
## 
## airr-py: 1.6.1
## airr-r: 1.6.1
## blast: 2.17.0
## cd-hit: 4.8.1
## igblast: 1.22.0
## muscle: 3.8.425
## phylip: 3.697
## raxml-ng: 2.0.2
## receptor-utils: 0.0.66
## vsearch: 2.30.0

Build versions

Use this command to list the date and changesets used during the image build:

builds report

## date: 2026-06-06 17:38:06 UTC
## immcantation: 4.4.0-575-gf74457779445+
## presto: 0.7.2-100-gc32a8f16a89c
## changeo: 1.3.0-120-g53038a0bf297
## alakazam: 1.2.0-334-ge85cde1e7f4d+
## shazam: 1.1.2-199-gcdf9f1c6712c+
## tigger: 157027c0b100+
## rdi: d27b9067cab6+
## scoper: 1.2.0-246-g810ad5a174a0+
## dowser: 2.4.1-86-g0323b17a372f+
## prestor: 0.0.8-4-gb9d9b80ff752+

Example data used in the tutorial

You can download the example data from Zenodo DOI. It is alreday available in the container Immcantation Lab: /home/magus/data/input.fasta: Processed B cell receptor reads from one healthy donor (PGP1) 3 weeks after flu vaccination (Laserson et al. (2014))

  • As part of the processing, each sequence has been annotated with the isotype.

  • This step is not a part of the tutorial, but you can learn how to do it here.

head /home/magus/data/input.fasta

## >seq1|ISOTYPE=IGHM
## nnnnnnnnnnnnnnnnnnnnnnnagtgtcaggtgcagctggtggagctggggagcgtggt
## ccagcctgggaggccctgagtctctcctgtgcagcctctggattcaccttcagtctctat
## gctatgcactgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatca
## tatcatgtaagcagtaaatactacgcagactccgtgaagggccgattcaccatctccaga
## gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggct
## gtgtattactgtgcgagagggccctatagtactggttattactacgagcttgactactgg
## ggccagggaacgctcggtcacccgtctcctcacgggtagtgcatccgccccaaccc
## >seq2|ISOTYPE=IGHM
## nnnnnnnnnnnnnnnnnntgtcccaggtgcagctgcaggagtcgggcccaggactggtga

Reference germlines

The container has human and mouse reference V(D)J germline genes from IMGT (/usr/local/share/germlines/imgt) and the corresponding IgBLAST databases (/usr/local/share/igblast) for these germline repertoires. The training container also contains a modified version of these databases where allele IGHV3-20*04 has been removed, to be rediscovered by TIgGER. The modified databases are in /usr/local/share/germlines/imgt_test_tigger and /usr/local/share/igblast_test_tigger.

ls /usr/local/share/germlines/imgt

## IMGT.yaml
## human
## mouse
## rabbit
## rat
## rhesus_monkey

ls /usr/local/share/igblast

## database
## fasta
## internal_data
## optional_file

V(D)J gene annotation

The first step in the analysis of processed reads (input.fasta) is to annotate each read with its germline V(D)J gene alleles and to identify relevant sequence structure such as the CDR3 sequence. Immcantation provides tools to read the output of many popular V(D)J assignment tools, including IMGT/HighV-QUEST and IgBLAST.

Here, we will use IgBLAST. Change-O provides a wrapper script (AssignGenes.py) to run IgBLAST using the reference V(D)J germline sequences in the container.

A test with 200 sequences

It is often useful to prototype analysis pipelines using a small subset of sequences. For a quick test of Change-O’s V(D)J assignment tool, use SplitSeq.py to extract 200 sequences from input.fasta, then assign the V(D)J genes with AssignGenes.py.

mkdir -p results/igblast
SplitSeq.py sample -n 200 --outdir results --fasta -s /home/magus/data/input.fasta

##      START> SplitSeq
##    COMMAND> sample
##       FILE> input.fasta
## MAX_COUNTS> 200
##      FIELD> None
##     VALUES> None
## 
## PROGRESS> 22:27:07 |Reading files            | 0.0 minPROGRESS> 22:27:07 |Done                     | 0.0 min
## 
## PROGRESS> 22:27:07 |Sampling n=200           | 0.0 minPROGRESS> 22:27:07 |Done                     | 0.0 min
## 
## MAX_COUNT> 200
##   SAMPLED> 200
##    OUTPUT> input_sample1-n200.fasta
## 
## END> SplitSeq

AssignGenes.py performs V(D)J assignment with IgBLAST.

  • It requires the input sequences (-s) and a reference germlines database (-b). In this case, we use the germline database already available in the container.

  • The organism is specified with --organism and the type of receptor with --loci (ig for the B cell receptor).

  • Use --format blast to specify that the results should be in the fmt7 format.

  • Improved computational speed can be achieved by specifying the number of processors with --nproc.

AssignGenes.py igblast -s results/input_sample1-n200.fasta \
-b /usr/local/share/igblast_test_tigger --organism human --loci ig \
--format blast --outdir results/igblast --nproc 8

##    START> AssignGenes
##  COMMAND> igblast
##  VERSION> 1.22.0
##     FILE> input_sample1-n200.fasta
## ORGANISM> human
##     LOCI> ig
##    NPROC> 8
## 
## PROGRESS> 22:27:09 |Running IgBLAST          | 0.0 minPROGRESS> 22:27:12 |Done                     | 0.1 min
## 
##   PASS> 200
## OUTPUT> input_sample1-n200_igblast.fmt7
##    END> AssignGenes

V(D)J assignment using all the data

To run the command on all of the data, modify it to change the input file (-s) to the full data set. Please note that this may take some time to finish running.

AssignGenes.py igblast -s /home/magus/data/input.fasta \
-b /usr/local/share/igblast_test_tigger --organism human --loci ig \
--format blast --outdir results/igblast --nproc 8

##    START> AssignGenes
##  COMMAND> igblast
##  VERSION> 1.22.0
##     FILE> input.fasta
## ORGANISM> human
##     LOCI> ig
##    NPROC> 8
## 
## PROGRESS> 22:27:13 |Running IgBLAST          | 0.0 minPROGRESS> 22:42:33 |Done                     | 15.3 min
## 
##   PASS> 91010
## OUTPUT> input_igblast.fmt7
##    END> AssignGenes

Data standardization using Change-O

Once the V(D)J annotation is finished, the IgBLAST results are parsed into a standardized format suitable for downstream analysis. All tools in the Immcantation framework use this format, which allows for interoperability and provides flexibility when designing complex workflows.

In this example analysis, the fmt7 results from IgBLAST are converted into the AIRR format, a tabulated text file with one sequence per row. Columns provide the annotation for each sequence using standard column names as described here: https://docs.airr-community.org/en/latest/datarep/rearrangements.html.

Generate a standardized database file

The command line tool MakeDb.py igblast requires the original input sequence fasta file (-s) that was passed to the V(D)J annotation tool, as well as the V(D)J annotation results (-i). The argument --format airr specifies that the results should be converted into the AIRR format. The path to the reference germlines is provided by -r.

mkdir -p results/changeo
MakeDb.py igblast \
-s /home/magus/data/input.fasta -i results/igblast/input_igblast.fmt7 \
--format airr \
-r /usr/local/share/germlines/imgt_test_tigger/human/vdj/ --outdir results/changeo \
--outname data

##          START> MakeDB
##        COMMAND> igblast
##   ALIGNER_FILE> input_igblast.fmt7
##       SEQ_FILE> input.fasta
##          NPROC> 16
##        ASIS_ID> False
##     ASIS_CALLS> False
##       VALIDATE> strict
##       EXTENDED> False
## INFER_JUNCTION> False
## 
## PROGRESS> 22:42:33 |Loading files       | 0.0 minPROGRESS> 22:42:34 |Done                | 0.0 min
## 
## PROGRESS> 22:42:34 |                    |   0% (     0) 0.0 minPROGRESS> 22:42:36 |#                   |   5% ( 4,551) 0.0 minPROGRESS> 22:42:38 |##                  |  10% ( 9,102) 0.1 minPROGRESS> 22:42:39 |###                 |  15% (13,653) 0.1 minPROGRESS> 22:42:41 |####                |  20% (18,204) 0.1 minPROGRESS> 22:42:43 |#####               |  25% (22,755) 0.2 minPROGRESS> 22:42:45 |######              |  30% (27,306) 0.2 minPROGRESS> 22:42:47 |#######             |  35% (31,857) 0.2 minPROGRESS> 22:42:49 |########            |  40% (36,408) 0.3 minPROGRESS> 22:42:51 |#########           |  45% (40,959) 0.3 minPROGRESS> 22:42:53 |##########          |  50% (45,510) 0.3 minPROGRESS> 22:42:54 |###########         |  55% (50,061) 0.3 minPROGRESS> 22:42:56 |############        |  60% (54,612) 0.4 minPROGRESS> 22:42:58 |#############       |  65% (59,163) 0.4 minPROGRESS> 22:43:00 |##############      |  70% (63,714) 0.4 minPROGRESS> 22:43:02 |###############     |  75% (68,265) 0.5 minPROGRESS> 22:43:04 |################    |  80% (72,816) 0.5 minPROGRESS> 22:43:06 |#################   |  85% (77,367) 0.5 minPROGRESS> 22:43:08 |##################  |  90% (81,918) 0.6 minPROGRESS> 22:43:10 |################### |  95% (86,469) 0.6 minPROGRESS> 22:43:11 |####################| 100% (91,010) 0.6 min
## 
## OUTPUT> data_db-pass.tsv
##   PASS> 87640
##   FAIL> 3370
##    END> MakeDb

Subset the data to include productive heavy chain sequences

We next filter the data from the previous step to include only productive sequences from the heavy chain. The determination of whether a sequence is productive (or not) is provided by the V(D)J annotation software.

ParseDb.py select finds the rows in the file -d for which the column productive (specified with -f) contains the values T or TRUE (specified by -u). The prefix data_p will be used in the name of the output file (specified by --outname).

ParseDb.py select -d results/changeo/data_db-pass.tsv \
-f productive -u T --outname data_p

##   START> ParseDb
## COMMAND> select
##    FILE> data_db-pass.tsv
##  FIELDS> productive
##  VALUES> T
##   REGEX> False
## 
## PROGRESS> 22:43:12 |                    |   0% (     0) 0.0 minPROGRESS> 22:43:13 |#                   |   5% ( 4,382) 0.0 minPROGRESS> 22:43:13 |##                  |  10% ( 8,764) 0.0 minPROGRESS> 22:43:13 |###                 |  15% (13,146) 0.0 minPROGRESS> 22:43:13 |####                |  20% (17,528) 0.0 minPROGRESS> 22:43:13 |#####               |  25% (21,910) 0.0 minPROGRESS> 22:43:13 |######              |  30% (26,292) 0.0 minPROGRESS> 22:43:13 |#######             |  35% (30,674) 0.0 minPROGRESS> 22:43:13 |########            |  40% (35,056) 0.0 minPROGRESS> 22:43:13 |#########           |  45% (39,438) 0.0 minPROGRESS> 22:43:14 |##########          |  50% (43,820) 0.0 minPROGRESS> 22:43:14 |###########         |  55% (48,202) 0.0 minPROGRESS> 22:43:14 |############        |  60% (52,584) 0.0 minPROGRESS> 22:43:14 |#############       |  65% (56,966) 0.0 minPROGRESS> 22:43:14 |##############      |  70% (61,348) 0.0 minPROGRESS> 22:43:14 |###############     |  75% (65,730) 0.0 minPROGRESS> 22:43:14 |################    |  80% (70,112) 0.0 minPROGRESS> 22:43:14 |#################   |  85% (74,494) 0.0 minPROGRESS> 22:43:14 |##################  |  90% (78,876) 0.0 minPROGRESS> 22:43:14 |################### |  95% (83,258) 0.0 minPROGRESS> 22:43:15 |####################| 100% (87,640) 0.0 min
## 
##    OUTPUT> data_p_parse-select.tsv
##   RECORDS> 87640
##  SELECTED> 64855
## DISCARDED> 22785
##       END> ParseDb

Next, we filter the data to include only heavy chain sequences.

ParseDb.py select finds the rows in the file -d from the previous step for which the column v_call (specified with -f) contains (pattern matching specified by --regex) the word IGHV (specified by -u). The prefix data_ph (standing for productive and heavy) will be used in the name of the output file (specified by --outname) to indicate that this file contains productive (p) heavy (h) chain sequence data.

ParseDb.py select -d results/changeo/data_p_parse-select.tsv \
-f v_call -u IGHV --regex --outname data_ph

##   START> ParseDb
## COMMAND> select
##    FILE> data_p_parse-select.tsv
##  FIELDS> v_call
##  VALUES> IGHV
##   REGEX> True
## 
## PROGRESS> 22:43:15 |                    |   0% (     0) 0.0 minPROGRESS> 22:43:15 |#                   |   5% ( 3,243) 0.0 minPROGRESS> 22:43:16 |##                  |  10% ( 6,486) 0.0 minPROGRESS> 22:43:16 |###                 |  15% ( 9,729) 0.0 minPROGRESS> 22:43:16 |####                |  20% (12,972) 0.0 minPROGRESS> 22:43:16 |#####               |  25% (16,215) 0.0 minPROGRESS> 22:43:16 |######              |  30% (19,458) 0.0 minPROGRESS> 22:43:16 |#######             |  35% (22,701) 0.0 minPROGRESS> 22:43:16 |########            |  40% (25,944) 0.0 minPROGRESS> 22:43:16 |#########           |  45% (29,187) 0.0 minPROGRESS> 22:43:16 |##########          |  50% (32,430) 0.0 minPROGRESS> 22:43:16 |###########         |  55% (35,673) 0.0 minPROGRESS> 22:43:17 |############        |  60% (38,916) 0.0 minPROGRESS> 22:43:17 |#############       |  65% (42,159) 0.0 minPROGRESS> 22:43:17 |##############      |  70% (45,402) 0.0 minPROGRESS> 22:43:17 |###############     |  75% (48,645) 0.0 minPROGRESS> 22:43:17 |################    |  80% (51,888) 0.0 minPROGRESS> 22:43:17 |#################   |  85% (55,131) 0.0 minPROGRESS> 22:43:17 |##################  |  90% (58,374) 0.0 minPROGRESS> 22:43:17 |################### |  95% (61,617) 0.0 minPROGRESS> 22:43:17 |####################| 100% (64,855) 0.0 min
## 
##    OUTPUT> data_ph_parse-select.tsv
##   RECORDS> 64855
##  SELECTED> 64855
## DISCARDED> 0
##       END> ParseDb

Load libraries and read in the data

After loading the libraries needed, the process is started by using read_rearrangement to read the tabulated data generated in the previous step.

suppressPackageStartupMessages(library(airr))
suppressPackageStartupMessages(library(alakazam))
suppressPackageStartupMessages(library(dplyr))
suppressPackageStartupMessages(library(ggplot2))
suppressPackageStartupMessages(library(tigger))

dir.create(file.path("results", "tigger"))

## Warning in dir.create(file.path("results", "tigger")): 'results/tigger' already
## exists

db <- read_rearrangement(file.path("results", "changeo",
                                   "data_ph_parse-select.tsv"))
colnames(db) # show the column names in the database

##  [1] "sequence_id"        "sequence"           "rev_comp"          
##  [4] "productive"         "v_call"             "d_call"            
##  [7] "j_call"             "sequence_alignment" "germline_alignment"
## [10] "junction"           "junction_aa"        "v_cigar"           
## [13] "d_cigar"            "j_cigar"            "stop_codon"        
## [16] "vj_in_frame"        "locus"              "c_call"            
## [19] "junction_length"    "np1_length"         "np2_length"        
## [22] "v_sequence_start"   "v_sequence_end"     "v_germline_start"  
## [25] "v_germline_end"     "d_sequence_start"   "d_sequence_end"    
## [28] "d_germline_start"   "d_germline_end"     "j_sequence_start"  
## [31] "j_sequence_end"     "j_germline_start"   "j_germline_end"    
## [34] "isotype"

Remove sequences with many Ns using filterN

Bulk BCR data in general includes ambiguous nucleotides (Ns), and we will remove those low-quality sequences with many Ns

# Source helper function also available here:
# https://github.com/immcantation/immcantation/tree/master/training/assets/filterN.R
source("assets/filterN.R")

# Identify sequences with at least 20 Ns or continuous 15 Ns in the v_region
v_n_stretches_plot <- filterN(db, "sequence_alignment", start=1, end=312, 
                              max_n=20, max_n_stretch = 15, label="v_region",
                              plot=TRUE)

v_region_n_pass <- v_n_stretches_plot$db_pass
# number of sequences before filtering N
dim(db)

## [1] 64855    34

db = db[which(v_region_n_pass),]
# number of sequences after filtering N
dim(db)

## [1] 64855    34

Genotyping and discovery of novel V gene alleles with TIgGER

V(D)J assignment is a key step in analyzing repertoires and is done by matching the sequences against a database of known V(D)J alleles. However, current databases are incomplete and this process will fail for sequences that utilize previously undetected alleles. Some assignments may also occur to genes which are not carried by the individual. The TIgGER R package infers subject-specific V genotypes (including novel alleles), then uses the results to improve the V gene annotations.

readIgFasta loads the reference V germline genes that were used in the V(D)J assignment (in this case the sequences in the Immcantation container).

ighv <- readIgFasta(file.path("", "usr", "local", "share", "germlines",
                              "imgt_test_tigger", "human", "vdj",
                              "imgt_human_IGHV.fasta"))
ighv[1] # show the first germline

##                                                                                                                                                                                                                                                                                                                        IGHV1-18*01 
## "CAGGTTCAGCTGGTGCAGTCTGGAGCT...GAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTTACACCTTT............ACCAGCTATGGTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAGCGCTTAC......AATGGTAACACAAACTATGCACAGAAGCTCCAG...GGCAGAGTCACCATGACCACAGACACATCCACGAGCACAGCCTACATGGAGCTGAGGAGCCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGA"

Identify potentially novel V gene alleles

For each V gene allele, findNovelAlleles analyzes the sequences that were assigned the allele and evaluates the apparent mutation frequency at each position as a function of sequence-wide mutation counts. Positions that contain polymorphisms (rather than somatic hypermutations) will exhibit a high apparent mutation frequency even when the sequence-wide mutation count is low.

In this example, TIgGER finds one novel V gene allele.

nv <- findNovelAlleles(db, germline_db = ighv, nproc = 8) # find novel alleles

## Duplicated polymorphism(s) found!. See the field 'note' in your results for more details.

selectNovel(nv) # show novel alleles

##   germline_call                                            note
## 1   IGHV3-20*01 Novel allele found!. Same as: IGHV3-20*05_G104A
## 2   IGHV3-20*03                             Novel allele found!
##   polymorphism_call nt_substitutions
## 1 IGHV3-20*01_C307T           307C>T
## 2  IGHV3-20*03_T68G            68T>G
##                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             novel_imgt
## 1                                                                                                                                                                                                                                                                     GAGGTGCAGCTGGTGGAGTCTGGGGGA...GGTGTGGTACGGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTT............GATGATTATGGCATGAGCTGGGTCCGCCAAGCTCCAGGGAAGGGGCTGGAGTGGGTCTCTGGTATTAATTGGAAT......GGTGGTAGCACAGGTTATGCAGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCCGAGGACACGGCCTTGTATTACTGTGCGAGAGA
## 2 GAGGTGCAGCTGGTGGAGTCTGGGGGA...GGTGTGGTACGGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTT............GATGATTATGGCATGAGCTGGGTCCGCCAAGCTCCAGGGAAGGGGCTGGAGTGGGTCTCTGGTATTAATTGGAAT......GGTGGTAGCACAGGTTATGCAGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCCGAGGACACGGCCTTGTATTACTGTGCGAGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTT............GATGATTATGGCATGAGCTGGGTCCGCCAAGCTCCAGGGAAGGGGCTGGAGTGGGTCTCTGGTATTAATTGGAAT......GGTGGTAGCACAGGTTATGCAGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCCGAGGACACGGCCTTGTATTACTGTGCGAGAGA
##   novel_imgt_count novel_imgt_unique_j novel_imgt_unique_cdr3
## 1              161                   6                    145
## 2              161                   6                    145
##   perfect_match_count perfect_match_freq germline_call_count germline_call_freq
## 1                 144          0.4982699                 289              0.004
## 2                 167          0.6162362                 271              0.004
##   mut_min mut_max mut_pass_count
## 1       1      10            200
## 2       1      10            220
##                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          germline_imgt
## 1                                                                                                                                                                                                                                                                     GAGGTGCAGCTGGTGGAGTCTGGGGGA...GGTGTGGTACGGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTT............GATGATTATGGCATGAGCTGGGTCCGCCAAGCTCCAGGGAAGGGGCTGGAGTGGGTCTCTGGTATTAATTGGAAT......GGTGGTAGCACAGGTTATGCAGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCCGAGGACACGGCCTTGTATCACTGTGCGAGAGA
## 2 GAGGTGCAGCTGGTGGAGTCTGGGGGA...GGTGTGGTACGGCCTGGGGGGTCCCTGAGACTCTCCTTTGCAGCCTCTGGATTCACCTTT............GATGATTATGGCATGAGCTGGGTCCGCCAAGCTCCAGGGAAGGGGCTGGAGTGGGTCTCTGGTATTAATTGGAAT......GGTGGTAGCACAGGTTATGCAGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCCGAGGACACGGCCTTGTATTACTGTGCGAGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTT............GATGATTATGGCATGAGCTGGGTCCGCCAAGCTCCAGGGAAGGGGCTGGAGTGGGTCTCTGGTATTAATTGGAAT......GGTGGTAGCACAGGTTATGCAGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCCGAGGACACGGCCTTGTATTACTGTGCGAGAGA
##   germline_imgt_count pos_min pos_max y_intercept y_intercept_pass snp_pass
## 1                  44       1     312       0.125                1      194
## 2                   0       1     312       0.125                1      220
##   unmutated_count unmutated_freq unmutated_snp_j_gene_length_count
## 1             144      0.4982699                                52
## 2             167      0.6162362                                54
##   snp_min_seqs_j_max_pass alpha min_seqs j_max min_frac
## 1                       1  0.05       50  0.15     0.75
## 2                       1  0.05       50  0.15     0.75

The function plotNovel helps visualize the supporting evidence for calling the novel V gene allele. The mutation frequency of the position that is predicted to contain a polymorphism is highlighted in red. In this case, the position contains a high number of apparent mutations for all sequence-wide mutation counts (top panel).

By default, findNovelAlleles uses several additional filters to avoid false positive allele calls. For example, to avoid calling novel alleles resulting from clonally-related sequences, TIgGER requires that sequences perfectly matching the potential novel allele be found in sequences with a diverse set of J genes and a range of junction lengths. This can be observed in the bottom panel.

plotNovel(db, selectNovel(nv)[1, ]) # visualize the novel allele(s)

Genotyping, including novel V gene alleles

The next step is to infer the subject’s genotype and use this to improve the V gene calls.

inferGenotype uses a frequency-based method to determine the genotype. For each V gene, it finds the minimum set of alleles that can explain a specified fraction of each gene’s calls. The most commonly observed allele of each gene is included in the genotype first, then the next most common allele is added until the desired fraction of sequence annotations can be explained.

Immcantation also includes other methods for inferring subject-specific genotypes (inferGenotypeBayesian).

gt <- inferGenotype(db, germline_db = ighv, novel = nv)

# save genotype inf .fasta format to be used later with dowser::createGermlines
gtseq <- genotypeFasta(gt, ighv, nv)
writeFasta(gtseq, file.path("results", "tigger", "v_genotype.fasta"))

gt %>% arrange(total) %>% dplyr::slice(1:3) # show the first 3 rows

##       gene alleles counts total note
## 1  IGHV2-5   02,01  58,48   109     
## 2 IGHV3-49   04,05  77,39   116     
## 3 IGHV3-11   01,04  85,53   138

The individual’s genotype can be visualized with plotGenotype. Each row is a gene, with colored cells indicating each of the alleles for that gene that are included in the inferred genotype.

plotGenotype(gt) # genotyping including novel V gene alleles

Reassign V gene allele annotations

Some of the V gene calls may use genes that are not part of the subject-specific genotype inferred by TIgGER. These gene calls can be corrected with reassignAlleles. Mistaken allele calls can arise, for example, from sequences which by chance have been mutated to look like another allele. reassignAlleles saves the corrected calls in a new column, v_call_genotyped.

With write_rearrangement the updated data is saved as a tabulated file for use in the following steps.

db <- reassignAlleles(db, gtseq)

# show some of the corrected gene calls
db %>%
  dplyr::filter(v_call != v_call_genotyped) %>%
  sample_n(3) %>%
  select(v_call, v_call_genotyped)

## # A tibble: 3 x 2
##   v_call                               v_call_genotyped        
##   <chr>                                <chr>                   
## 1 IGHV3-20*01,IGHV3-20*03,IGHV3-20*05  IGHV3-20*01_C307T       
## 2 IGHV3-23*01,IGHV3-23*04,IGHV3-23D*01 IGHV3-23*01,IGHV3-23D*01
## 3 IGHV3-9*04                           IGHV3-9*01

write_rearrangement(db, file.path("results", "tigger", "data_ph_genotyped.tsv"))

Clonal diversity analysis

Goal: Partition (cluster) sequences into clonally related lineages. Each lineage is a group of sequences that came from the same original naive cell.

Summary of the key steps: * Determine clonal clustering threshold: sequences which are under this cut-off are clonally related. * Assign clonal groups: add an annotation (clone_id) that can be used to identify a group of sequences that came from the same original naive cell. * Reconstruct germline sequences: figure out the germline sequence of the common ancestor, before mutations are introduced during clonal expansion and SMH. * Analyze clonal diversity: number and size of clones? any expanded clones?

Clonal assignment using the CDR3 as a fingerprint

Clonal relationships can be inferred from sequencing data. Hierarchical clustering is a widely used method for identify clonally related sequences. This method requires a measure of distance between pairs of sequences and a choice of linkage to define the distance between groups of sequences. Since the result will be a tree, a threshold to cut the hierarchy into discrete clonal groups is also needed.

The figure below shows a tree and the chosen threshold (red dotted line). Sequences which have a distance under this threshold are considered to be part of the same clone (i.e., clonally-related) whereas sequences which have distance above this threshold are considered to be part of independent clones (i.e., not clonally related).

shazam provides methods to calculate the distance between sequences and find an appropriate distance threshold for each dataset (distToNearest and findThreshold). The threshold can be determined by analyzing the distance to the nearest distribution. This is the set of distances between each sequence and its closest non-identical neighbor.

The figure below shows the distance-to-nearest distribution for a repertoire. Typically, the distribution is bimodal. The first mode (on the left) represents sequences that have at least one clonal relative in the dataset, while the second mode (on the right) is representative of the sequences that do not have any clonal relatives in the data (sometimes called “singletons”). A reasonable threshold will separate these two modes of the distribution. In this case, it is easy to manually determine a threshold as a value intermediate between the two modes. However, findThreshold can be used to automatically find the threshold.

Setting the clonal distance threshold with SHazaM

We first split sequences into groups that share the same V and J gene assignments and that have the same junction (or equivalently CDR3) length. This is based on the assumption that members of a clone will share all of these properties. distToNearest performs this grouping step, then counts the number of mismatches in the junction region between all pairs of sequences in each group and returns the smallest non-zero value for each sequence. At the end of this step, a new column (dist_nearest) which contains the distances to the closest non-identical sequence in each group will be added to db.

findThreshold uses the distribution of distances calculated in the previous step to determine an appropriate threshold for the dataset. This can be done using either a density or mixture based method. The function plot can be used to visualize the distance-to-nearest distribution and the threshold.

# get the distance to nearest neighbors
suppressPackageStartupMessages(library(shazam))
db <- distToNearest(db, model = "ham", normalize = "len",
                    vCallColumn = "v_call_genotyped", nproc = 4)

## Running in non-single-cell mode.

# determine the threshold
threshold <- findThreshold(db$dist_nearest, method = "density")
thr <- round(threshold@threshold, 2)
thr

## [1] 0.12

plot(threshold) # plot the distribution

Advanced method: Spectral-based clonal clustering (SCOPer)

In some datasets, the distance-to-nearest distribution may not be bimodal and findThreshold may fail to determine the distance threshold. In these cases, spectral clustering with an adaptive threshold to determine the local sequence neighborhood may be used. This can be done with functions from the SCOPer R package.

Clonal assignment

Once a threshold is decided, the function hierarchicalClones from the SCOPer R package performs the clonal assignment. There are some arguments that usually need to be specified: * model: the distance metric used in distToNearest * normalize: type of normalization used in distToNearest * threshold: the cut-off from findThreshold

At the end of this step, the output file will have an additional column (clone_id) that provides an identifier for each sequence to indicate which clone it belongs to (i.e., sequences that have the same identifier are clonally-related). Note that these identifiers are only unique to the dataset used to carry out the clonal assignments.

suppressPackageStartupMessages(library(scoper))
# Clonal assignment using hierarchical clustering
results <- hierarchicalClones(db, threshold=thr, v_call="v_call_genotyped", summarize_clones=TRUE)

## Warning in prepare_db(db = db, junction = junction, v_call = v_call, j_call =
## j_call, : Removed 52 sequences with non ATCG characters.

# Plot a histogram of inter and intra clonal distances
plot(results, binwidth=0.02)

Dowser: lineage reconstruction

B cell repertoires often consist of hundreds to thousands of separate clones. A clonal lineage recapitulates the ancestor-descendant relationships between clonally-related B cells and uncovering these relationships can provide insights into affinity maturation. The R package dowser offers multiple ways to build B cell phylogenetic trees. Before performing lineage reconstruction, some preprocessing in needed.

Create germlines

The goal is to reconstruct the sequence of the unmutated ancestor of each clone. We use a reference database of known alleles (IMGT). Because it is very difficult to accurately infer the D region and the junction region for BCR sequences, we mask this region with N.

Before B cell lineage trees can be built, it is necessary to construct the unmutated germline sequence for each B cell clone. Typically the IGH D segment is masked because the junction region of heavy chains often cannot be reliably reconstructed. Note that occasionally errors are thrown for some clones - this is typical and usually results in those clones being excluded.

In the example below, we read in the IMGT germline references from our Docker container. If you’re using a local installation, you can download the most up-to-date reference genome by cloning the Immcantation repository and running the script:

# Retrieve reference genome with the script fetch_imgtdb.sh.
# It will create directories where it is run
git clone https://bitbucket.org/kleinstein/immcantation.git
./immcantation/scripts/fetch_imgtdb.sh 

And passing "human/vdj/" to the readIMGT function.

# read in IMGT data if downloaded on your own (above)
# and update `dir` to use the path to your `human/vdj` folder
# references <- readIMGT(dir = "human/vdj/")

# read in IMGT files in the Docker container
references <- dowser::readIMGT(dir = "/usr/local/share/germlines/imgt/human/vdj")

## [1] "Read in 1305 from 17 fasta files"

# reconstruct germlines
results@db <- dowser::createGermlines(results@db, references, nproc = 1)

Format clones

In the rearrangement table, each row corresponds to a sequence, and each column is information about that sequence. We will create a new data structure, where each row is a clonal cluster, and each column is information about that clonal cluster. The function formatClones performs this processing and has options that are relevant to determine how the trees can be built and visualized. For example, traits determines the columns from the rearrangement data that will be included in the clones object, and will also be used to determine the uniqueness of the sequences, so they are not collapsed.

# make clone objects with aligned, processed sequences
# collapse identical sequences unless differ by trait
# add up duplicate_count column for collapsed sequences
# store day, gex_annotation
# discard clones with < 5 distinct sequences
clones <- dowser::formatClones(results@db, traits="isotype", minseq = 5,
                               nproc = 1)
head(clones)

## # A tibble: 6 x 4
##   clone_id data       locus  seqs
##   <chr>    <list>     <chr> <int>
## 1 15759    <airrClon> IGH      35
## 2 13805    <airrClon> IGH      33
## 3 19218    <airrClon> IGH      33
## 4 5360     <airrClon> IGH      32
## 5 20994    <airrClon> IGH      26
## 6 27722    <airrClon> IGH      23

Build trees with dowser

Dowser offers multiple ways to build B cell phylogenetic trees. These differ by the method used to estimate tree topology and branch lengths (e.g. maximum parsimony and maximum likelihood) and implementation (IgPhyML, PHYLIP, RAxML, or R packages ape and phangorn). Each method has pros and cons. In this tutorial we use PHYLIP to reconstruct lineages following a maximum parsimony technique. PHYLIP is already installed in the Immcantation container.

# the executable path is the location of the executable in the Docker container
trees <- dowser::getTrees(clones, 
                          build = "dnapars", exec = "/usr/local/bin/dnapars", 
                          nproc = 1)
head(trees)

## # A tibble: 6 x 5
##   clone_id data       locus  seqs trees  
##   <chr>    <list>     <chr> <int> <list> 
## 1 15759    <airrClon> IGH      35 <phylo>
## 2 13805    <airrClon> IGH      33 <phylo>
## 3 19218    <airrClon> IGH      33 <phylo>
## 4 5360     <airrClon> IGH      32 <phylo>
## 5 20994    <airrClon> IGH      26 <phylo>
## 6 27722    <airrClon> IGH      23 <phylo>

Plot trees with dowser and ggtree

Regardless of how you build trees, they are visualized in the same manner with the plotTrees function. This will return a list of ggplot objects in the same order as the input object. Here, we color the tips by the isotype value because we specified that column in the formatClones step.

Plot all of the trees:

plots_all <- dowser::plotTrees(trees, tips = "isotype", tipsize = 2)

Plot the largest tree:

plots_all[[1]]

# save a pdf of all trees
dowser::treesToPDF(plots_all,
                   file = file.path("intro-lab_files", "final_data_trees.pdf"),
                   nrow = 2, ncol = 2)

## png 
##   2

In addition to the functions for building and visualizing trees, dowser also implements new techniques for analyzing B cell migration and differentiation, as well as for detecting new B cell evolution over time. Visit the dowser website to learn more.

SHazaM: mutational load

B cell repertoires differ in the number of mutations introduced during somatic hypermutation (SHM). The shazam R package provides a wide array of methods focused on the analysis of SHM, including the reconstruction of SHM targeting models and quantification of selection pressure.

Having identified the germline sequence (germline_alignment_d_mask) in previous steps, we first identify the set of somatic hypermutations by comparing the observed sequence (sequence_alignment) to the germline sequence. observedMutations is next used to quantify the mutational load of each sequence using either absolute counts (frequency=F) or as a frequency (the number of mutations divided by the number of informative positions (frequency=T). Each mutation can be defined as either a replacement mutation (R, or non-synonymous mutation, which changes the amino acid sequence) or a silent mutation (S, or synonymous mutation, which does not change the amino acid sequence). R and S mutations can be counted together (conmbine=T) or independently (combine=F). Counting can be limited to mutations occurring within a particular region of the sequence (for example, to focus on the V region regionDefinition=IMGT_V) or use the whole sequence (regionDefinition=NULL).

Standard ggplot commands can be used to generate boxplots to visualize the distribution of mutation counts across sequences, which are found in the column mu_count that observedMutations added to db.

# Calculate total mutation count, R and S combined
results@db <- observedMutations(results@db,
                                sequenceColumn = "sequence_alignment", 
                                germlineColumn = "germline_alignment_d_mask",
                                regionDefinition = NULL, frequency = FALSE,
                                combine = TRUE, nproc = 4)

ggplot(results@db, aes(x = isotype, y = mu_count, fill = isotype)) +
  geom_boxplot() +
  scale_fill_manual(name = "Isotype", values = IG_COLORS) +
  labs(x = "Isotype", y = "Mutation count") +
  theme_bw()

SHazaM: models of SHM targeting biases

SHM is a stochastic process, but does not occur uniformly across the V(D)J sequence. Some nucleotide motifs (i.e., hot-spots) are targeted more frequently than others (i.e., cold-spots). These intrinsic biases are modeled using 5-mer nucleotide motifs. For each 5-mer (e.g., ATCTA), a SHM mutability model provides the relative likelihood for the center base (e.g., the C in ATCTA) to be mutated. As associated substitution model provides the relative probabilities of the center base in a 5-mer mutating to each of the other 3 bases. There are several pre-built SHM targeting models included in shazam which have been constructed based on experimental datasets. These include models for human and mouse, and for both light and heavy chains. In addition, shazam provides the createTargetingModel method to generate new SHM targeting models from user-supplied sequencing data. 5mer The resulting model can be visualized as a hedgehog plot with plotMutability. In this visualization, 5-mers that belong to classically-defined SHM hot-spot motifs (e.g., WRC) are shown in red and green, cold-spot motifs in blue, and other motifs (i.e., neutral) in grey. The bars radiating outward are the relative mutabilities of each 5-mer. The middle circle is the central nucleotide being targeted for SHM, here shown by a green circle on the left plot (nucleotide A) and an orange circle on the right plot (nucleotide C). Moving from the center of the circle outward covers the 5-mer nucleotide motif (5’ to 3’). As expected, higher relative mutation rates are observed at hot-spot motifs.

# Build and plot SHM targeting model
m <- createTargetingModel(results@db, vCallColumn = "v_call_genotyped")

## Warning in createMutabilityMatrix(db, sub_mat, model = model, sequenceColumn =
## sequenceColumn, : Insufficient number of mutations to infer some 5-mers. Filled
## with 0.

# nucleotides: center nucleotide characters to plot
plotMutability(m, nucleotides = c("A","C"), size = 1.2)

SHazaM: quantification of selection pressure

During T-cell dependent adaptive immune responses, B cells undergo cycles of SHM and affinity-dependent selection that leads to the accumulation of mutations that improve their ability to bind antigens. The ability to estimate selection pressure from sequence data is of interest to understand the events driving physiological and pathological immune responses. shazam incorporates the Bayesian estimation of Antigen-driven SELectIoN (BASELINe) framework, to detect and quantify selection pressure, based on the analysis of somatic hypermutation patterns. Briefly, calcBaseline analyzes the observed frequency of replacement and silent mutations normalized by their expected frequency based on a targeting model, and generates a probability density function (PDF) for the selection strength (∑). This PDF can be used to statistically test for the occurrence of selection, as well as compare selection strength across conditions. An increased frequency of R mutations (∑ > 0) suggests positive selection, and a decreased frequency of R mutations (∑ < 0) points towards negative selection .

positive Σ: Replacement frequency higher than expected

negative Σ: Replacement frequency lower than expected

The somatic hypermutations that are observed in clonally-related sequences are not independent events. In order to generate a set of independent SHM events, selection pressure analysis starts by collapsing each clone to one representative sequence (with its associated germline) using the function collapseClones. Next calcBaseline takes each representative sequences and calculates the selection pressure. The analysis can be focused on a particular region, the V region (regionDefinition=IMGT_V) in the example below. Because selection pressure may act differently across the BCR, we may also be interested to evaluate the selection strength for different regions such as the Complementary Determining Regions (CDR) or Framework Regions (FWR) separately. Selection strength can also be calculated separately for different isotopes or subjects. This can be done with groupbaseline, which convolves the PDFs from individual sequences into a single PDF representing the group of sequences (e.g., all IgG sequences). These PDF can be visualized with plot. FWR are critical to maintenance the overall structure of the BCR and typically have a lower observed selection strength, because mutations that alter the amino acid sequence are often negatively selected. CDRs are the areas of the BCR that generally bind to the antigen and may be subject to increased selection strength, although this can depend on the point in affinity maturation when the sequence is observed. In the example, negative selection is observed in the FWR, and almost no selection is observed in the CDR. In both CDR and FWR, sequences annotated with IGHM isotype show more positive selection strength than sequences annotated with IGHG and IGHA.

# Calculate clonal consensus and selection using the BASELINe method
z <- collapseClones(results@db)
b <- calcBaseline(z, regionDefinition = IMGT_V)

## calcBaseline will calculate observed and expected mutations for clonal_sequence using clonal_germline as a reference.

## Calculating BASELINe probability density functions...

# Combine selection scores for all clones in each group
g <- groupBaseline(b, groupBy = "isotype")

## Grouping BASELINe probability density functions...
## Calculating BASELINe statistics...

# Plot probability densities for the selection pressure
plot(g, "isotype", sigmaLimits = c(-1, 1), silent = F)

SHazaM: Built in mutation models

shazam comes with several pre-built targeting models, mutation models and sequence region definitions. They can be used to change the default behavior of many functions. For example, mutations are usually defined as R when they introduce any change in the amino acid sequence (NULL). However, for some analyses, it may be useful to consider some amino acid substitutions to be equivalent (i.e., treated as silent mutations). For example, it is possible to define replacement mutations as only those that introduce a change in the amino acid side chain charge (CHARGE_MUTATIONS).

Empirical SHM Targeting Models

  • HH_S5F: Human heavy chain 5-mer model

  • HKL_S5F: Human light chain 5-mer model

  • MK_RS5NF: Mouse light chain 5-mer model

Mutation Definitions

  • NULL: Any mutation that results in an amino acid substitution is considered a replacement (R) mutation.

  • CHARGE_MUTATIONS: Only mutations that alter side chain charge are replacements.

  • HYDOPATHY_MUTATIONS: Only mutations that alter hydrophobicity class are replacements.

  • POLARITY_MUTATIONS: Only mutations that alter polarity are replacements.

  • VOLUME_MUTATIONS: Only mutations that alter volume class are replacements.

Sequence Region Definitions

  • NULL: Full sequence

  • IMGT_V: V segment broken into combined CDRs and FWRs

  • IMGT_V_BY_REGIONS: V segment broken into individual CDRs and FWRs

Run a start-to-finish Immcantation workflow

The most common BCR and TCR repertoire analysis steps are implemented in the nf-core/airrflow workflow. This workflow is particularly useful for analyzing a large amount of samples in parallel. To know more about the workflow, check out the nf-core/airrflow documentation. The documentation includes a bulk tutorial that guides you through the steps of running the workflow for bulk datasets.